Review



cdna microarray experiment  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher cdna microarray experiment
    The RNA samples prepared for Affymetrix <t>microarray</t> experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.
    Cdna Microarray Experiment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+microarray+experiments/pmc04432801-150-19-18
    Average 90 stars, based on 1 article reviews
    cdna microarray experiment - by Bioz Stars, 2026-10
    90/100 stars

    Images

    1) Product Images from "Global Characteristics of CSIG-Associated Gene Expression Changes in Human HEK293 Cells and the Implications for CSIG Regulating Cell Proliferation and Senescence"

    Article Title: Global Characteristics of CSIG-Associated Gene Expression Changes in Human HEK293 Cells and the Implications for CSIG Regulating Cell Proliferation and Senescence

    Journal: Frontiers in Endocrinology

    doi: 10.3389/fendo.2015.00069

    The RNA samples prepared for Affymetrix microarray experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.
    Figure Legend Snippet: The RNA samples prepared for Affymetrix microarray experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.

    Techniques Used: Microarray, Western Blot, Expressing, Transfection, Electrophoresis

    Agreement between microarray and real-time quantitative RT-PCR data . The blue block represent microarray data, the red block represent real-time PCR results. The results are mean ± SEM and the P -values are all <0.05.
    Figure Legend Snippet: Agreement between microarray and real-time quantitative RT-PCR data . The blue block represent microarray data, the red block represent real-time PCR results. The results are mean ± SEM and the P -values are all <0.05.

    Techniques Used: Microarray, Quantitative RT-PCR, Blocking Assay, Real-time Polymerase Chain Reaction

    Verification of  microarray  data by quantitative real-time PCR .
    Figure Legend Snippet: Verification of microarray data by quantitative real-time PCR .

    Techniques Used: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Activation Assay

    Related Articles

    Recombinant:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    cDNA Synthesis:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    SYBR Green Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Blocking Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Cell Stimulation:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Staining:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Electron Microscopy:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Conjugation Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Antibody Labeling:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Gene Knockout:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    DNA Extraction:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Enzyme-linked Immunosorbent Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    CyQUANT Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Proliferation Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Gene Expression:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Microarray:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Software:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Incubation:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Expressing:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Functional Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Control:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Polymerase Chain Reaction:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Reverse Transcription:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Labeling:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Quantitative RT-PCR:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Real-time Polymerase Chain Reaction:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Multiplex Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    TaqMan Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Countercurrent Chromatography:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Generated:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Isolation:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Red Blood Cell Lysis:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Concentration Assay:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Sequencing:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.


    Extraction:

    Article Title: Mesenchymal stem cells populations, their products, and use thereof
    Article Snippet: Microarray Analyses Mirna Array: The experiments were performed using Affymetrix HU GENE1.0st oligonucleotide arrays.

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [2].

    Article Title: Acute and chronic impact of interleukin-33 stimulation on chemokines and growth factors in human cord blood-derived mast cells
    Article Snippet: Two biological replicates for microarray experiments were assessed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific), according to the manufacturer’s instructions, as previously described [ ].

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.

    Article Title: Acute and prolonged effects of interleukin-33 on cytokines in human cord blood-derived mast cells.
    Article Snippet: Two biological replicates for microarray experiments were performed using Affymetrix Gene Chip Human Gene 1.0 ST arrays (Thermo Fisher Scientific) according to the manufacturer’s instructions.




    Similar Products

    90
    Thermo Fisher cdna microarray experiment
    The RNA samples prepared for Affymetrix <t>microarray</t> experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.
    Cdna Microarray Experiment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+microarray+experiments/pmc04432801-150-19-18
    Average 90 stars, based on 1 article reviews
    cdna microarray experiment - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Welgene Biotech cdna microarray experiment
    The RNA samples prepared for Affymetrix <t>microarray</t> experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.
    Cdna Microarray Experiment, supplied by Welgene Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+microarray+experiments/microarray+analysis/pm18309246-40-1-7
    Average 90 stars, based on 1 article reviews
    cdna microarray experiment - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    SuperArray Bioscience Corporation cdna microarray experiments
    The RNA samples prepared for Affymetrix <t>microarray</t> experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.
    Cdna Microarray Experiments, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+microarray+experiments/cdna+array/pm17139681-57-7-4
    Average 90 stars, based on 1 article reviews
    cdna microarray experiments - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Biotechnology Information cdna microarray experiments
    The RNA samples prepared for Affymetrix <t>microarray</t> experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.
    Cdna Microarray Experiments, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+microarray+experiments/cdna+microarray/pmc01287979-66-20-12
    Average 90 stars, based on 1 article reviews
    cdna microarray experiments - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Incyte corporation cdna microarray experiment
    The RNA samples prepared for Affymetrix <t>microarray</t> experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.
    Cdna Microarray Experiment, supplied by Incyte corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+microarray+experiments/cdna+microarray/pm15888328-60-5-11
    Average 90 stars, based on 1 article reviews
    cdna microarray experiment - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    GenAsia Biotech Co Ltd cdna microarray experiment
    The RNA samples prepared for Affymetrix <t>microarray</t> experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.
    Cdna Microarray Experiment, supplied by GenAsia Biotech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cdna+microarray+experiments/cdna+microarray+experiment/pm15763339-107-1-8
    Average 90 stars, based on 1 article reviews
    cdna microarray experiment - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    The RNA samples prepared for Affymetrix microarray experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.

    Journal: Frontiers in Endocrinology

    Article Title: Global Characteristics of CSIG-Associated Gene Expression Changes in Human HEK293 Cells and the Implications for CSIG Regulating Cell Proliferation and Senescence

    doi: 10.3389/fendo.2015.00069

    Figure Lengend Snippet: The RNA samples prepared for Affymetrix microarray experiment . Upper panel, western blot analysis of CSIG expression in siCSIG and siNC transiently transfected HEK293 cells. Total protein was extracted, and immunoblotting was performed using specific antibodies against CSIG as indicated. GAPDH served as a loading control. Bottom panel, the intactness of the RNA samples was tested using RNA electrophoresis. The three parallel experiments, indicated as 1, 2, and 3, respectively, were performed with the same siRNA.

    Article Snippet: Totally, the detection results indicated that the quality of RNA samples we prepared ultimately meets the requirements of Affymetrix cDNA microarray experiment.

    Techniques: Microarray, Western Blot, Expressing, Transfection, Electrophoresis

    Agreement between microarray and real-time quantitative RT-PCR data . The blue block represent microarray data, the red block represent real-time PCR results. The results are mean ± SEM and the P -values are all <0.05.

    Journal: Frontiers in Endocrinology

    Article Title: Global Characteristics of CSIG-Associated Gene Expression Changes in Human HEK293 Cells and the Implications for CSIG Regulating Cell Proliferation and Senescence

    doi: 10.3389/fendo.2015.00069

    Figure Lengend Snippet: Agreement between microarray and real-time quantitative RT-PCR data . The blue block represent microarray data, the red block represent real-time PCR results. The results are mean ± SEM and the P -values are all <0.05.

    Article Snippet: Totally, the detection results indicated that the quality of RNA samples we prepared ultimately meets the requirements of Affymetrix cDNA microarray experiment.

    Techniques: Microarray, Quantitative RT-PCR, Blocking Assay, Real-time Polymerase Chain Reaction

    Verification of  microarray  data by quantitative real-time PCR .

    Journal: Frontiers in Endocrinology

    Article Title: Global Characteristics of CSIG-Associated Gene Expression Changes in Human HEK293 Cells and the Implications for CSIG Regulating Cell Proliferation and Senescence

    doi: 10.3389/fendo.2015.00069

    Figure Lengend Snippet: Verification of microarray data by quantitative real-time PCR .

    Article Snippet: Totally, the detection results indicated that the quality of RNA samples we prepared ultimately meets the requirements of Affymetrix cDNA microarray experiment.

    Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Activation Assay